A Search Service for Abbreviation / Long Form

■ Search Result - Abbreviation : ODN

Search Conditions:
Search Keyword : ODN
Search Method : Exact match.
Research Area:

Results:  
Abbreviation: ODN
Appearance Frequency: 2001 time(s)
Long forms: 46

Display Settings:
[Entries Per Page]
 per page
Page Control
Page: of
Long Form No. Long Form Research Area Co-occurring Abbreviation PubMed/MEDLINE Info. (Year, Title)
oligodeoxynucleotide
(1787 times)
Allergy and Immunology
(384 times)
IL (62 times)
NF-kappaB (61 times)
TLR (57 times)
1988 Physicochemical properties of phosphorothioate oligodeoxynucleotides.
octadecaneuropeptide
(65 times)
Neurology
(25 times)
DBI (25 times)
CBR (9 times)
TTN (8 times)
1984 A brain octadecaneuropeptide generated by tryptic digestion of DBI (diazepam binding inhibitor) functions as a proconflict ligand of benzodiazepine recognition sites.
open donor nephrectomy
(53 times)
Transplantation
(20 times)
LDN (34 times)
HALDN (7 times)
HLDN (3 times)
1999 Laparoscopic versus open donor nephrectomy: comparing ureteral complications in the recipients and improving the laparoscopic technique.
odanacatib
(45 times)
Orthopedics
(21 times)
BMD (15 times)
CatK (14 times)
ALN (10 times)
2009 Effect of the cathepsin K inhibitor odanacatib on bone resorption biomarkers in healthy postmenopausal women: two double-blind, randomized, placebo-controlled phase I studies.
overt diabetic nephropathy
(5 times)
Internal Medicine
(2 times)
ADHF (1 time)
ARB (1 time)
CI (1 time)
1995 [Relationship between elevated plasma endothelin-1 level and renal function in patients with diabetic nephropathy].
antisense-oligodeoxynucleotide
(3 times)
Biochemistry
(1 time)
ECM (1 time)
hOAT4 (1 time)
IGF-I (1 time)
1993 Distribution and relevance of insulin-like growth factor-I receptor in metanephric development.
octadecaneuropeptide DBI(33-50)
(3 times)
Neurology
(2 times)
DBI (3 times)
1995 Inhibitory effect of the potential endogenous benzodiazepine receptor ligand, octadecaneuropeptide (ODN), on gonadotropin-releasing hormone gene expression in the male rat brain.
oxygen-driven nebulizer
(2 times)
Pediatrics
(1 time)
AECOPD (1 time)
NVS (1 time)
PEFR (1 time)
2002 Efficacy and safety of a home-made non-valved spacer for bronchodilator therapy in acute asthma.
1-(5,6-di-O-acetyl-2,3-dideoxy-3-phthalimido-alpha-D-arabino-hexofuranosyl)thymine and used in oligodeoxynucleotide
(1 time)
Biochemistry
(1 time)
--- 2004 Synthesis and incorporation of an alpha-hexofuranosyl thymidine into oligodeoxynucleotides via its two exocyclic OH-groups.
10  111In-oligonucleotide
(1 time)
Radiotherapy
(1 time)
FCS (1 time)
HPLC (1 time)
PBS (1 time)
2006 Binding with serum components favorably affects cellular uptake of 111In-oligonucleotide in a leukemia cell line.
11  cyanine-oligo-2'-deoxyribonucleotide
(1 time)
Chemistry
(1 time)
--- 2006 New cyanine-oligonucleotide conjugates: relationships between chemical structures and properties.
12  inhibitory-oligodeoxynucleotide
(1 time)
Dermatology
(1 time)
CIU (1 time)
IFN (1 time)
pDC (1 time)
2011 Impaired IFN-alpha secretion by plasmacytoid dendritic cells induced by TLR9 activation in chronic idiopathic urticaria.
13  labeled-oligonucleotide
(1 time)
Medicine
(1 time)
CTGF (1 time)
2016 A study on the transfection of antisense oligonucletide into kidney mediated by lipid microbubbles.
14  O-desmethylnaproxen
(1 time)
Toxicology
(1 time)
DMBI (1 time)
DMI (1 time)
EPR (1 time)
2017 An evaluation of myeloperoxidase-mediated bio-activation of NSAIDs in promyelocytic leukemia (HL-60) cells for potential cytotoxic selectivity.
15  o-dianisidine
(1 time)
Biochemistry
(1 time)
--- 2011 [Phenothiazines are slowly oxidizable substrates of horseradish peroxidase].
16  octadecaneuropeptide proteolytic product
(1 time)
Cell Biology
(1 time)
DBI (1 time)
OB (1 time)
SVZ (1 time)
2012 Diazepam binding inhibitor promotes progenitor proliferation in the postnatal SVZ by reducing GABA signaling.
17  ODN (16-nt) has diffusion constant D
(1 time)
Biophysics
(1 time)
CL-ODN (1 time)
2005 Characterization of interaction between cationic lipid-oligonucleotide complexes and cellular membrane lipids using confocal imaging and fluorescence correlation spectroscopy.
18  ODN A, a 54-mer oligodeoxynucleotide
(1 time)
Communicable Diseases
(1 time)
PPT (1 time)
SEVI (1 time)
2016 Abolishing HIV-1 infectivity using a polypurine tract-specific G-quadruplex-forming oligonucleotide.
19  ODN containing no CpG motif
(1 time)
Allergy and Immunology
(1 time)
CpG-ODN (1 time)
i.p (1 time)
2007 In vivo priming heterophil innate immune functions and increasing resistance to Salmonella enteritidis infection in neonatal chickens by immune stimulatory CpG oligodeoxynucleotides.
20  ODN-Raf
(1 time)
Cell Biology
(1 time)
--- 2009 A short hairpin DNA analogous to miR-125b inhibits C-Raf expression, proliferation, and survival of breast cancer cells.
21  oligodeoxynucleic acid
(1 time)
Cell Biology
(1 time)
--- 2017 The RNF146 E3 ubiquitin ligase is required for the control of Wnt signaling and body pattern formation in Xenopus.
22  oligodeoxynucleotide, 5'-GCCGAGGTCCATGTCGTACGC-3
(1 time)
Biochemistry
(1 time)
PLGA (1 time)
1997 Release behavior of poly(lactic acid-co-glycolic acid) implants containing phosphorothioate oligodeoxynucleotide.
23  oligodeoxynucleotides containing CpG motif
(1 time)
Biochemistry
(1 time)
TLR9 (1 time)
2010 Peptide conjugation at the 5'-end of oligodeoxynucleotides abrogates toll-like receptor 9-mediated immune stimulatory activity.
24  oligodeoxynucleotides with CpG motifs
(1 time)
Allergy and Immunology
(1 time)
alum (1 time)
i.p (1 time)
IgG (1 time)
2002 Improved immunogenicity and efficacy of the recombinant 19-kilodalton merozoite surface protein 1 by the addition of oligodeoxynucleotide and aluminum hydroxide gel in a murine malaria vaccine model.
25  oligonucleoside phosphorodithioate
(1 time)
Biochemistry
(1 time)
--- 2003 Immunofluorescence assay and flow-cytometry selection of bead-bound aptamers.
26  Oligonucleotide agents
(1 time)
Biochemistry
(1 time)
GJ (1 time)
OF (1 time)
RT (1 time)
2006 Delivery of double-stranded DNA thioaptamers into HIV-1 infected cells for antiviral activity.
27  oligonucleotide duplex
(1 time)
Polymers
(1 time)
ER (1 time)
ERE (1 time)
2000 Self-assembly of an oligodeoxyribonucleotide harboring the estrogen response element in the presence of polyamines: ionic, structural, and DNA sequence specificity effects.
28  oligonucleotide hybridization
(1 time)
Neoplasms
(1 time)
PCR (1 time)
SSCP (1 time)
1994 Melanoma metastases from patients with hereditary cutaneous malignant melanoma contain a high frequency of N-ras activating mutations.
29  oncogene (5'-d(TTACCCACCCTACCCACCCTCA))
(1 time)
Chemistry
(1 time)
--- 2018 Probing the Ionic Atmosphere and Hydration of the c-MYC i-Motif.
30  open DN using either flank incision
(1 time)
Transplantation
(1 time)
DN (1 time)
2004 Living donor nephrectomy: flank incision versus anterior vertical mini-incision.
31  open donation
(1 time)
Nephrology
(1 time)
HALDN (1 time)
2009 How safe is hand-assisted laparoscopic donor nephrectomy?--results of 200 live donor nephrectomies by two different techniques.
32  open donor
(1 time)
Urology
(1 time)
LDN (1 time)
2004 Fate of donor kidney: laparoscopic versus open technique.
33  open donor nephrectomy approach
(1 time)
Transplantation
(1 time)
LDN (1 time)
MILD (1 time)
2004 A comparison of traditional open, minimal-incision donor nephrectomy and laparoscopic donor nephrectomy.
34  Open living donor nephrectomy
(1 time)
Urology
(1 time)
--- 2010 Early and late graft function after laparoscopic hand-assisted donor nephrectomy for living kidney transplantation: comparison with open donor nephrectomy.
35  open renal donor nephrectomy
(1 time)
Urology
(1 time)
LDN (1 time)
2003 Ipsilateral orchialgia after laparoscopic donor nephrectomy.
36  open-flank donor nephrectomy
(1 time)
Organ Transplantation
(1 time)
MILIA (1 time)
2010 Mini-incision living donors nephrectomy using anterior muscle-splitting approach with hybrid technique.
37  optical distribution network
(1 time)
Ophthalmology
(1 time)
--- 2013 40Gb/s dynamic wavelength-division-multiplexing/time-division-multiplexing hybrid access network with energy and data stream synchronized transmission.
38  order to develop new oligodeoxyribonucleotide
(1 time)
Biochemistry
(1 time)
--- 2010 Synthesis, characterization and hybridization studies of an alternate nucleo-epsilon/gamma-peptide: complexes formation with natural nucleic acids.
39  orphan disease networks
(1 time)
Medicine
(1 time)
HDN (1 time)
MSUD (1 time)
PSGN (1 time)
2013 Global analysis of the human pathophenotypic similarity gene network merges disease module components.
40  osmotic dilution
(1 time)
Environmental Health
(1 time)
FO (1 time)
SWRO (1 time)
2012 A comparative life cycle assessment of hybrid osmotic dilution desalination and established seawater desalination and wastewater reclamation processes.
41  overexpression dominant-negative
(1 time)
Genetics
(1 time)
--- 2013 Dissecting protein function: an efficient protocol for identifying separation-of-function mutations that encode structurally stable proteins.
42  oxidative denitrosylation
(1 time)
Hematology
(1 time)
HbF (1 time)
NO (1 time)
2013 The oxidative denitrosylation mechanism and nitric oxide release from human fetal and adult hemoglobin, an experimentally based model simulation study.
43  peptide-oligonucleotide
(1 time)
Biochemistry
(1 time)
3HC (1 time)
NC (1 time)
2009 Sensing peptide-oligonucleotide interactions by a two-color fluorescence label: application to the HIV-1 nucleocapsid protein.
44  phosphorothioate-oligodeoxynucleotide
(1 time)
Cell Biology
(1 time)
PTHrP (1 time)
TRAP (1 time)
2000 Parathyroid hormone-related peptide is involved in protection against invasion of tooth germs by bone via promoting the differentiation of osteoclasts during tooth development.
45  porphyrin-oligonucleotide
(1 time)
Biochemistry
(1 time)
--- 2008 Synthesis and characterization of water-soluble free-base, zinc and copper porphyrin-oligonucleotide conjugates.
46  protein-oligodeoxyribonucleotide
(1 time)
Biochemistry
(1 time)
800CW-Cy (1 time)
FRET (1 time)
NIR (1 time)
2008 Near-infrared fluorescent oligodeoxyribonucleotide reporters for sensing NF-kappaB DNA interactions in vitro.