1 |
oligodeoxynucleotide
(1902 times)
|
Allergy and Immunology (407 times)
|
IL (67 times) TLR9 (66 times) NF-kappaB (65 times)
|
1988 Physicochemical properties of phosphorothioate oligodeoxynucleotides.
|
2 |
octadecaneuropeptide
(71 times)
|
Neurology (26 times)
|
DBI (26 times) CBR (9 times) TTN (8 times)
|
1984 A brain octadecaneuropeptide generated by tryptic digestion of DBI (diazepam binding inhibitor) functions as a proconflict ligand of benzodiazepine recognition sites.
|
3 |
odanacatib
(58 times)
|
Orthopedics (26 times)
|
CatK (18 times) BMD (17 times) ALN (10 times)
|
2009 Effect of the cathepsin K inhibitor odanacatib on bone resorption biomarkers in healthy postmenopausal women: two double-blind, randomized, placebo-controlled phase I studies.
|
4 |
open donor nephrectomy
(56 times)
|
Transplantation (20 times)
|
LDN (37 times) HALDN (7 times) WIT (4 times)
|
1999 Laparoscopic versus open donor nephrectomy: comparing ureteral complications in the recipients and improving the laparoscopic technique.
|
5 |
overt diabetic nephropathy
(5 times)
|
Internal Medicine (2 times)
|
ADHF (1 time) ARB (1 time) CI (1 time)
|
1995 [Relationship between elevated plasma endothelin-1 level and renal function in patients with diabetic nephropathy].
|
6 |
antisense-oligodeoxynucleotide
(3 times)
|
Biochemistry (1 time)
|
ECM (1 time) hOAT4 (1 time) IGF-I (1 time)
|
1993 Distribution and relevance of insulin-like growth factor-I receptor in metanephric development.
|
7 |
octadecaneuropeptide DBI(33-50)
(3 times)
|
Neurology (2 times)
|
DBI (3 times)
|
1995 Inhibitory effect of the potential endogenous benzodiazepine receptor ligand, octadecaneuropeptide (ODN), on gonadotropin-releasing hormone gene expression in the male rat brain.
|
8 |
optical distribution network
(3 times)
|
Ophthalmology (2 times)
|
BER (1 time) Cc (1 time) Ch (1 time)
|
2013 40Gb/s dynamic wavelength-division-multiplexing/time-division-multiplexing hybrid access network with energy and data stream synchronized transmission.
|
9 |
Oncology Data Network
(2 times)
|
Neoplasms (2 times)
|
---
|
2019 The Oncology Data Network (ODN): A Collaborative European Data-Sharing Platform to Inform Cancer Care.
|
10 |
Operational Delivery Networks
(2 times)
|
Pediatrics (1 time)
|
PHE (1 time)
|
2019 The continuing impact of capacity on a region's in utero transfer requests.
|
11 |
Oxidative-denitrogenation
(2 times)
|
Chemistry, Physical (1 time)
|
ED (1 time) HbF (1 time) IND (1 time)
|
2012 The oxidative denitrosylation mechanism and nitric oxide release from human fetal and adult hemoglobin, an experimentally based model simulation study.
|
12 |
oxygen-driven nebulization
(2 times)
|
Pediatrics (1 time)
|
AECOPD (1 time) NVS (1 time) PEFR (1 time)
|
2002 Efficacy and safety of a home-made non-valved spacer for bronchodilator therapy in acute asthma.
|
13 |
1-(5,6-di-O-acetyl-2,3-dideoxy-3-phthalimido-alpha-D-arabino-hexofuranosyl)thymine and used in oligodeoxynucleotide
(1 time)
|
Biochemistry (1 time)
|
---
|
2004 Synthesis and incorporation of an alpha-hexofuranosyl thymidine into oligodeoxynucleotides via its two exocyclic OH-groups.
|
14 |
111In-oligonucleotide
(1 time)
|
Therapeutics (1 time)
|
FCS (1 time) HPLC (1 time) PBS (1 time)
|
2006 Binding with serum components favorably affects cellular uptake of 111In-oligonucleotide in a leukemia cell line.
|
15 |
cyanine-oligo-2'-deoxyribonucleotide
(1 time)
|
Chemistry (1 time)
|
---
|
2006 New cyanine-oligonucleotide conjugates: relationships between chemical structures and properties.
|
16 |
inhibitory-oligodeoxynucleotide
(1 time)
|
Dermatology (1 time)
|
CIU (1 time) IFN (1 time) pDC (1 time)
|
2011 Impaired IFN-alpha secretion by plasmacytoid dendritic cells induced by TLR9 activation in chronic idiopathic urticaria.
|
17 |
labeled-oligonucleotide
(1 time)
|
Medicine (1 time)
|
CTGF (1 time)
|
2016 A study on the transfection of antisense oligonucletide into kidney mediated by lipid microbubbles.
|
18 |
O-desmethylnaproxen
(1 time)
|
Toxicology (1 time)
|
DMBI (1 time) DMI (1 time) EPR (1 time)
|
2017 An evaluation of myeloperoxidase-mediated bio-activation of NSAIDs in promyelocytic leukemia (HL-60) cells for potential cytotoxic selectivity.
|
19 |
o-dianisidine
(1 time)
|
Biochemistry (1 time)
|
---
|
2012 [Phenothiazines are slowly oxidizable substrates of horseradish peroxidase].
|
20 |
octadecaneuropeptide proteolytic product
(1 time)
|
Cell Biology (1 time)
|
DBI (1 time) OB (1 time) SVZ (1 time)
|
2012 Diazepam binding inhibitor promotes progenitor proliferation in the postnatal SVZ by reducing GABA signaling.
|
21 |
ODN (16-nt) has diffusion constant D
(1 time)
|
Biophysics (1 time)
|
CL-ODN (1 time)
|
2004 Characterization of interaction between cationic lipid-oligonucleotide complexes and cellular membrane lipids using confocal imaging and fluorescence correlation spectroscopy.
|
22 |
ODN A, a 54-mer oligodeoxynucleotide
(1 time)
|
Communicable Diseases (1 time)
|
PPT (1 time) SEVI (1 time)
|
2016 Abolishing HIV-1 infectivity using a polypurine tract-specific G-quadruplex-forming oligonucleotide.
|
23 |
ODN containing no CpG motif
(1 time)
|
Allergy and Immunology (1 time)
|
CpG-ODN (1 time) i.p (1 time)
|
2007 In vivo priming heterophil innate immune functions and increasing resistance to Salmonella enteritidis infection in neonatal chickens by immune stimulatory CpG oligodeoxynucleotides.
|
24 |
ODN-Raf
(1 time)
|
Cell Biology (1 time)
|
---
|
2009 A short hairpin DNA analogous to miR-125b inhibits C-Raf expression, proliferation, and survival of breast cancer cells.
|
25 |
oligodeoxynucleic acid
(1 time)
|
Cell Biology (1 time)
|
---
|
2017 The RNF146 E3 ubiquitin ligase is required for the control of Wnt signaling and body pattern formation in Xenopus.
|
26 |
oligodeoxynucleotide, 5'-GCCGAGGTCCATGTCGTACGC-3
(1 time)
|
Biochemistry (1 time)
|
PLGA (1 time)
|
1997 Release behavior of poly(lactic acid-co-glycolic acid) implants containing phosphorothioate oligodeoxynucleotide.
|
27 |
oligodeoxynucleotides containing CpG motif
(1 time)
|
Biochemistry (1 time)
|
TLR9 (1 time)
|
2009 Peptide conjugation at the 5'-end of oligodeoxynucleotides abrogates toll-like receptor 9-mediated immune stimulatory activity.
|
28 |
oligodeoxynucleotides with CpG motifs
(1 time)
|
Allergy and Immunology (1 time)
|
alum (1 time) i.p (1 time) IgG (1 time)
|
2002 Improved immunogenicity and efficacy of the recombinant 19-kilodalton merozoite surface protein 1 by the addition of oligodeoxynucleotide and aluminum hydroxide gel in a murine malaria vaccine model.
|
29 |
oligonucleoside phosphorodithioate
(1 time)
|
Biochemistry (1 time)
|
---
|
2003 Immunofluorescence assay and flow-cytometry selection of bead-bound aptamers.
|
30 |
Oligonucleotide agents
(1 time)
|
Biochemistry (1 time)
|
GJ (1 time) OF (1 time) RT (1 time)
|
2006 Delivery of double-stranded DNA thioaptamers into HIV-1 infected cells for antiviral activity.
|
31 |
oligonucleotide duplex
(1 time)
|
Polymers (1 time)
|
ER (1 time) ERE (1 time)
|
2001 Self-assembly of an oligodeoxyribonucleotide harboring the estrogen response element in the presence of polyamines: ionic, structural, and DNA sequence specificity effects.
|
32 |
oligonucleotide hybridization
(1 time)
|
Neoplasms (1 time)
|
PCR (1 time) SSCP (1 time)
|
1994 Melanoma metastases from patients with hereditary cutaneous malignant melanoma contain a high frequency of N-ras activating mutations.
|
33 |
oligonucleotides with the native
(1 time)
|
Pharmacology (1 time)
|
IAV (1 time)
|
2021 Pronounced therapeutic potential of oligonucleotides fixed on inorganic nanoparticles against highly pathogenic H5N1 influenza A virus in vivo.
|
34 |
oncogene (5'-d(TTACCCACCCTACCCACCCTCA))
(1 time)
|
Chemistry (1 time)
|
---
|
2018 Probing the Ionic Atmosphere and Hydration of the c-MYC i-Motif.
|
35 |
ondansetron
(1 time)
|
Biocompatible Materials (1 time)
|
AL (1 time) CyD (1 time)
|
2013 beta-Cyclodextrin-crosslinked alginate gel for patient-controlled drug delivery systems: regulation of host-guest interactions with mechanical stimuli.
|
36 |
open DN
(1 time)
|
|
BMI (1 time) DN (1 time) LDN (1 time)
|
2022 Donor Nephrectomy Through Mini-Flank Incision: A Single-Centre Experience Among Nigerian Patients.
|
37 |
open DN using either flank incision
(1 time)
|
Transplantation (1 time)
|
DN (1 time)
|
2004 Living donor nephrectomy: flank incision versus anterior vertical mini-incision.
|
38 |
open donation
(1 time)
|
Nephrology (1 time)
|
HALDN (1 time)
|
2008 How safe is hand-assisted laparoscopic donor nephrectomy?--results of 200 live donor nephrectomies by two different techniques.
|
39 |
open donor
(1 time)
|
Urology (1 time)
|
LDN (1 time)
|
2004 Fate of donor kidney: laparoscopic versus open technique.
|
40 |
open donor nephrectomy approach
(1 time)
|
Transplantation (1 time)
|
LDN (1 time) MILD (1 time)
|
2004 A comparison of traditional open, minimal-incision donor nephrectomy and laparoscopic donor nephrectomy.
|
41 |
Open living donor nephrectomy
(1 time)
|
Urology (1 time)
|
---
|
2010 Early and late graft function after laparoscopic hand-assisted donor nephrectomy for living kidney transplantation: comparison with open donor nephrectomy.
|
42 |
open renal donor nephrectomy
(1 time)
|
Urology (1 time)
|
LDN (1 time)
|
2003 Ipsilateral orchialgia after laparoscopic donor nephrectomy.
|
43 |
open-flank donor nephrectomy
(1 time)
|
Organ Transplantation (1 time)
|
MILIA (1 time)
|
2010 Mini-incision living donors nephrectomy using anterior muscle-splitting approach with hybrid technique.
|
44 |
order to develop new oligodeoxyribonucleotide
(1 time)
|
Biochemistry (1 time)
|
---
|
2008 Synthesis, characterization and hybridization studies of an alternate nucleo-epsilon/gamma-peptide: complexes formation with natural nucleic acids.
|
45 |
orphan disease networks
(1 time)
|
Medicine (1 time)
|
HDN (1 time) MSUD (1 time) PSGN (1 time)
|
2013 Global analysis of the human pathophenotypic similarity gene network merges disease module components.
|
46 |
osmotic dilution
(1 time)
|
Environmental Health (1 time)
|
FO (1 time) SWRO (1 time)
|
2012 A comparative life cycle assessment of hybrid osmotic dilution desalination and established seawater desalination and wastewater reclamation processes.
|
47 |
overexpression dominant-negative
(1 time)
|
Genetics (1 time)
|
---
|
2013 Dissecting protein function: an efficient protocol for identifying separation-of-function mutations that encode structurally stable proteins.
|
48 |
peptide-oligonucleotide
(1 time)
|
Biochemistry (1 time)
|
3HC (1 time) NC (1 time)
|
2009 Sensing peptide-oligonucleotide interactions by a two-color fluorescence label: application to the HIV-1 nucleocapsid protein.
|
49 |
phosphorothioate-oligodeoxynucleotide
(1 time)
|
Cell Biology (1 time)
|
PTHrP (1 time) TRAP (1 time)
|
2000 Parathyroid hormone-related peptide is involved in protection against invasion of tooth germs by bone via promoting the differentiation of osteoclasts during tooth development.
|
50 |
porphyrin-oligonucleotide
(1 time)
|
Biochemistry (1 time)
|
---
|
2008 Synthesis and characterization of water-soluble free-base, zinc and copper porphyrin-oligonucleotide conjugates.
|
51 |
protein-oligodeoxyribonucleotide
(1 time)
|
Biochemistry (1 time)
|
800CW-Cy (1 time) FRET (1 time) NIR (1 time)
|
2008 Near-infrared fluorescent oligodeoxyribonucleotide reporters for sensing NF-kappaB DNA interactions in vitro.
|